What would be observed by two objects moving at near-light speed towards one another? |
- What would be observed by two objects moving at near-light speed towards one another?
- Has Earth always been in the Sun’s habitable zone? If not, when did it start to occupy the Goldilocks zone?
- Is crying an inflammatory process?
- AskScience AMA Series: We're Rachel Davis, MD, and Moksha Patel, MD, instructors at the CU School of Medicine. With Rachel's expertise, Moksha decided to undergo deep brain stimulation surgery for OCD. AUA!
- Why isn't 'apparent gravity' greater at the poles?
- Do we have a wider field of view when our pupils dilate in the dark?
- What are the trade-offs for waiting longer in between COVID booster shots in terms of long-term and short-term protection?
- Soybeans look very similar to other green beans. What makes soybeans produce so much more oil? There is no green bean oil, or english pea oil, or edamame oil.
- Why do so many new drug names end in umab?
- Are there any elements that we've only found on Earth and there's no evidence of them elsewhere?
- Why do mammalian antibodies have a light chain?
- Is there any correlation between the sequence of gRNA used and the probability of the template DNA being accepted and used for Homologous Recombination?
- Why is cold water better for removing blood than hot water?
- If you were standing on Mars, how bright would it’s two moons look in comparison to our Moon on Earth?
- Why is IgE antibody always associated with pollen but other types not? What exactly is the impact of the type of antibody?
- Does our brain have some sort of internal timer/alarm clock when something becomes a routine?
- China has used "fireworks" to break up cloud formations and bring blue skies. Could this technique be used to dissipate a tornado, to save lives and reduce damage?
- When a broken bone heals improperly and it needs to be re-broken, how do doctors ensure it breaks correctly to heal properly again?
- Is there any research being done on reducing tick populations?
- In what way do SSRI (antidepressant) cause long term sexual dysfunction?
- Is the sky a different colour blue at different latitudes?
- Could we ride a conventional bike on the Moon?
- Why would land surface temperature be higher than air temperature?
- Do fruit trees always need a “partner” to bear fruit?
| What would be observed by two objects moving at near-light speed towards one another? Posted: 03 May 2022 10:38 AM PDT From how I understand it, all velocities are relative, and nothing can surpass the speed of light. So I would assume this means you can't observe anything move faster than C, but what I can't grasp is what an object moving at, say, 99% of C would observe if another object was moving at the same velocity towards it. Would it be observed as moving nearly twice the speed of light? Or would some special relativity time dilation fuckery make this impossible? [link] [comments] |
| Posted: 03 May 2022 08:18 PM PDT |
| Is crying an inflammatory process? Posted: 03 May 2022 08:21 PM PDT After I cry, especially for a while, my eyes feel sore and my eyelids get puffy and red, and they can take almost a day to feel back to normal. I also feel tired for the next +/-12 hours. Is there an inflammatory feedback mechanism from crying? Also, this brings up another question: does anyone know the scientific or evolutionary origin and purpose of crying? Is it an adaptation? Thanks 🥲 [link] [comments] |
| Posted: 03 May 2022 04:00 AM PDT Hi, Reddit. We're Rachel Davis, MD, (u/racheldavismd) and Moksha Patel, MD, (u/mokshapatelmd). We're here to answer your questions about deep brain stimulation and OCD, obsessive compulsive disorder. If you are struggling with OCD, you are not alone. Treatments and care are evolving. Deep brain stimulation or DBS is a rare, invasive brain surgery where electrodes are implanted in the deeper structures of the brain. These electrodes are then connected to generators in the chest that deliver small currents of electricity to the brain, similar to cardiac pacemakers. About Rachel: I'm Rachel Davis, MD, associate professor of psychiatry at the University of Colorado School of Medicine. I'm also medical director of the OCD, Obsessive Compulsive Disorder, program and co-director of the OCD surgical program. I've extensively studied deep brain stimulation for OCD and have worked with candidates, like Moksha, before, during and after the process. About Moksha: And I'm Moksha Patel, senior instructor of hospital medicine at the University of Colorado School of Medicine where I hold many roles. I've always been high-achieving and busy my whole life; working hard has helped me cope with crippling OCD. I recently worked with Dr. Davis and many others to undergo deep brain stimulation. I've put in a lot of work with Dr. Davis programming my stimulator settings and engaging in intensive exposure therapy. It's been a challenging process, but I'm happy to say I'm feeling relief; I am more engaged in life and can travel, go out with friends and go about my day to day without being completely stuck in my head. I'm also working toward an MBA at the University of Colorado Denver. Links:
We'll begin answering questions at 9AM MT (8AM PT/11AM ET/15 UT). AUA! [link] [comments] |
| Why isn't 'apparent gravity' greater at the poles? Posted: 03 May 2022 09:21 AM PDT If centifugal force increases with the radius of rotation (all else staying the same), why doesn't our apparent weight vary depending on our relative distance from the equator i.e. if there is less centrifugal force at the North/South Pole to balance the constant gravity, why don't we feel like we weigh more? [link] [comments] |
| Do we have a wider field of view when our pupils dilate in the dark? Posted: 02 May 2022 07:11 PM PDT In the dark our pupils get wider, which I would imagine means there is a larger angle of light that we can see, and the opposite for our pupils shrinking in brightness. Is this actually how it works? [link] [comments] |
| Posted: 03 May 2022 12:12 PM PDT It's my understanding that waiting longer between COVID boosters allows for a greater production of both regular B cells and plasma cells (the latter of which are a type of B cell that sit in our bone marrow, producing antibodies for long periods of time). And I've seen some experts, such as E. John Wherry, point out that spacing boosters close together, even four months apart, may result in a trade-off between short-term protection against infection provided by antibodies and long-term protection from infection from severe disease and death conferred by B cells and T cells. I'm curious just how significant this trade-off is. If one had a booster four months ago, would they be more likely to get better long-term protection against severe outcomes if they were to wait an additional four or five months for a fall booster? Or is the trade-off for waiting relatively minor, such that they would be likely to get better overall protection if they were to get a booster now and then again in the fall, in about six months? (In addition to being less likely to catch COVID for the next two months or so after getting a booster.) [link] [comments] |
| Posted: 03 May 2022 08:50 PM PDT |
| Why do so many new drug names end in umab? Posted: 02 May 2022 11:19 PM PDT Just wondered what it's derived from. I've seen many drugs ending in umab or mab, especially in clinical trials. [link] [comments] |
| Are there any elements that we've only found on Earth and there's no evidence of them elsewhere? Posted: 03 May 2022 06:46 PM PDT |
| Why do mammalian antibodies have a light chain? Posted: 03 May 2022 12:56 PM PDT So I'm reading about antibodies, saw that sharks and camels don't have light chains in their antibodies, tried to look more into why they only have heavy chains and found (according to what I read) that they are more stable, smaller, have higher affinity, and can go places where antibodies with light chains can't. So now the question I can't find an answer to is why have a light chain then? Like why do most other large animals have a light chain if it seems to make your antibodies less effective? TL;DR Having no light chain in your antibody seems to make it a better antibody, so why do most mammals have antibodies with light chains? [link] [comments] |
| Posted: 03 May 2022 05:58 PM PDT I recently completed a self-directed experiment where I used CRISPR-Cas9 to edit non-pathogenic E. coli so that it would grow on streptomycin agar media. I forced a mutation in the ribosomal subunit protein rpsL to change a single DNA base, so the Lysine amino acid at position 43 is replaced with Threonine. It was successful as I did see small bacteria colonies on my agar plates, but it was much less than it should have been. I had ordered premade gRNA (GGAGTTCGGTTTTTTAGGAG) in order to complete this experiment. The protocol I followed recommended this sequence because of its closeness to the actual position in the gene and because it would increase the likelihood of the template DNA being accepted into the cell for Homologous Recombination. Is there any correlation between the sequence of gRNA used and the probability of the template DNA being accepted and used for Homologous Recombination? I feel like this is very far-fetched but I am curious. Sorry if this is confusing, please let me know if I need to clarify anything. [link] [comments] |
| Why is cold water better for removing blood than hot water? Posted: 02 May 2022 04:21 PM PDT |
| Posted: 01 May 2022 08:26 PM PDT |
| Posted: 03 May 2022 07:05 AM PDT |
| Does our brain have some sort of internal timer/alarm clock when something becomes a routine? Posted: 02 May 2022 03:17 PM PDT In my early teens my parents had a parental control in the family computer which included allowing only 4 hours of screen time in my profile. When it reached the last 15 minutes it would show a prompt with a few options. The thing is that after a few months and maybe a year of this parental control I started "sensing" when the 15 minutes prompt would appear, to the point where I would pause my game or whatever I was doing to wait for it to appear so I could close it, and I never had to wait for more than 1 or 2 minutes for that (every now and then I would get a false alarm but those were rare). I would just start getting a "bad" feeling when it was going to happen, almost as if my brain started a timer when I logged into the computer and it would go off when the "bad thing" was about to happen. And no, I wasn't looking at the clock, I was too into my game to the point where I would forget to blink. Just asking this because I got curious when remembering this, and I'm a potato when it comes to psychology or neuroscience or whatever this falls into. [link] [comments] |
| Posted: 01 May 2022 07:39 PM PDT |
| Posted: 02 May 2022 08:05 PM PDT |
| Is there any research being done on reducing tick populations? Posted: 02 May 2022 05:22 PM PDT I live in Nova Scotia, Canada my entire life and honest to God I had never seen or even heard of ticks IRL until recent years. To note: I've never been much of an outdoorsy/woods type person to begin with. Now that we have to do tick checks every single time we take the dog outside, and the fact that my house is in a rural area surrounded by tall grass and forests, the thought of ticks and Lyme is a regular source of nightmare fuel for me. The news of an upcoming vaccine for Lyme does not comfort me, because no date or rollout anytime soon means it might as well not even be news. I hate these fucking things just as much as anyone else. While I wasn't interested in interacting with nature before, now I'm just anxious about it. I understand climate change is mainly causing the booming population. Deer population seemingly being at an all time high around here also adds to it. All I'd like to know is this: What, if any, research or science (yes this sounds dumb) is being done to combat this in the slightest? This is a worldwide issue by now, and I hate the idea that we are all just gonna have to accept our new tick overlords. [link] [comments] |
| In what way do SSRI (antidepressant) cause long term sexual dysfunction? Posted: 02 May 2022 04:36 PM PDT In the literature there have been rising number of studies/reviews done on PSSD (post ssri sexual dysfunction), with the recent track since the EMA accepted it as a syndrome page 5. [link] [comments] |
| Is the sky a different colour blue at different latitudes? Posted: 02 May 2022 12:32 PM PDT I recently traveled from Canada to the Bahamas. When I left the sky was a pale icy blue, when I arrived the sky seemed darker, closer to indigo blue. Is Raleigh scattering affected by latitude? Was it another atmospheric phenomenon or was it just my imagination? [link] [comments] |
| Could we ride a conventional bike on the Moon? Posted: 02 May 2022 09:34 AM PDT If spacesuits were as light and flexible as normal clothing would we be able to ride a conventional mountain-bike on the Moon? My question regards the physics of riding the bike, not the economics or the feasibility of such an endeavor. [link] [comments] |
| Why would land surface temperature be higher than air temperature? Posted: 02 May 2022 02:58 PM PDT So I stumbled upon this post, and it got me thinking about why land temperature would be higher than the air temperature. I suspect it's a heat capacity thing but I'm having trouble taking that concept and using it to arrive at why that would be the case. [link] [comments] |
| Do fruit trees always need a “partner” to bear fruit? Posted: 02 May 2022 12:32 PM PDT As I understand, a fruit (for example, an apple) is created when the flowers of a tree get pollinated. So, if I were to plant a single apple tree on an island in the middle of the ocean, it would not bear any fruit right? Is this the case for all trees or are there any that can give fruit "asexually"? [link] [comments] |
| You are subscribed to email updates from AskScience: Got Questions? Get Answers.. To stop receiving these emails, you may unsubscribe now. | Email delivery powered by Google |
| Google, 1600 Amphitheatre Parkway, Mountain View, CA 94043, United States | |
No comments:
Post a Comment