Pages

Wednesday, May 4, 2022

Does the original strain of Covid still exist in the wild or has it been completely replaced by more recent variants?

Does the original strain of Covid still exist in the wild or has it been completely replaced by more recent variants?


Does the original strain of Covid still exist in the wild or has it been completely replaced by more recent variants?

Posted: 04 May 2022 07:30 AM PDT

What do we know about any kind of lasting immunity?

Is humanity likely to have to live with Covid forever?

If Covid is going to stick around for a long time I guess that means that not only will we have potential to catch a cold and flu but also Covid every year?

I tested positive for Covid on Monday so I've been laying in bed wondering about stuff like this.

submitted by /u/froggy_diggum
[link] [comments]

In areas with distinct summer/winter seasons, there is a peak in pollen levels in the spring and early summer. Are there similar "pollen seasons" in tropical climate?

Posted: 04 May 2022 06:28 AM PDT

Ask Anything Wednesday - Engineering, Mathematics, Computer Science

Posted: 04 May 2022 07:01 AM PDT

Welcome to our weekly feature, Ask Anything Wednesday - this week we are focusing on Engineering, Mathematics, Computer Science

Do you have a question within these topics you weren't sure was worth submitting? Is something a bit too speculative for a typical /r/AskScience post? No question is too big or small for AAW. In this thread you can ask any science-related question! Things like: "What would happen if...", "How will the future...", "If all the rules for 'X' were different...", "Why does my...".

Asking Questions:

Please post your question as a top-level response to this, and our team of panellists will be here to answer and discuss your questions. The other topic areas will appear in future Ask Anything Wednesdays, so if you have other questions not covered by this weeks theme please either hold on to it until those topics come around, or go and post over in our sister subreddit /r/AskScienceDiscussion , where every day is Ask Anything Wednesday! Off-theme questions in this post will be removed to try and keep the thread a manageable size for both our readers and panellists.

Answering Questions:

Please only answer a posted question if you are an expert in the field. The full guidelines for posting responses in AskScience can be found here. In short, this is a moderated subreddit, and responses which do not meet our quality guidelines will be removed. Remember, peer reviewed sources are always appreciated, and anecdotes are absolutely not appropriate. In general if your answer begins with 'I think', or 'I've heard', then it's not suitable for /r/AskScience.

If you would like to become a member of the AskScience panel, please refer to the information provided here.

Past AskAnythingWednesday posts can be found here. Ask away!

submitted by /u/AutoModerator
[link] [comments]

How long is the process from the first nuclear fusion inside a protostar until can be called an actual star?

Posted: 04 May 2022 05:18 AM PDT

Why does the Collatz Conjecture (and problems like it) matter?

Posted: 04 May 2022 09:11 AM PDT

I was watching a video from one of the 3628468 youtube channels that the bearded englishman has and it mentioned this problem and I started to think, why does such a thing matter? Seems like just a funny maths thing for a child to play with but in the video the host mentioned that people have "ruined" their careers trying to solve the problem.

What would happen if the problem was proved false/true? Is this a check on if maths as a whole work or something?

If there is a simple and obvious answer, I do apologize. I'm just a lowly car mechanic and a bass player on top of that.

submitted by /u/HuudaHarkiten
[link] [comments]

Why is that a whole glass pane breaks even when the contact is only at one point?

Posted: 04 May 2022 06:13 AM PDT

What was climate and flora and fauna like 90 000 years ago around the ice lakes of Northern Russia?

Posted: 04 May 2022 03:22 AM PDT

Especially around modern White Sea, Lake Komi and West Siberian Ice Lake as seen in this image that depicts these lakes 90 000 years ago:

https://johnhawks.net/images/glacial-lake-west-siberia-mangerud-2004.jpg

submitted by /u/sakor88
[link] [comments]

Which causes hair loss? Too High or too low testosterone?

Posted: 04 May 2022 03:14 AM PDT

I often hear that either one or the other causes your hair to fall off. Which is both?

submitted by /u/Vlad_117
[link] [comments]

Does the body process blended fruit and vegetables in a smoothie significantly different than consuming them whole?

Posted: 03 May 2022 09:41 AM PDT

I can't seem to find a whole lot of scientifically tested information on this subject. Assuming a smoothie made only with whole foods (no added sugar or juice - just extra water to aid with blending), my two questions are:

a. Does a blender shred the fruit/vegetable fiber too small and significantly reduce how long you "feel full"?

b. Would the shredded fiber and juice separated in the blending process cause a significant spike in sugar intake and therefore spike insulin?

Ultimately is there a significant difference in having the blender do the work for you instead of chewing?

Follow up: Would consuming the smoothie over a long period of time, say over the course of 3-4 hours vs. consuming the whole foods withing one hour have any significant difference?

submitted by /u/Thosepassionfruits
[link] [comments]

How does a simple refracting telescope make more stars visible?

Posted: 03 May 2022 02:37 PM PDT

My intuition is totally failing me here. If something is invisible to the naked eye, why would magnification make it visible? I can understand how a reflecting telescope that collects a lot of light does this, but it isn't clear to me how a simple arrangement of lens would.

submitted by /u/worthwhileredditing
[link] [comments]

Why do volcanos erupt?

Posted: 04 May 2022 05:07 AM PDT

Gravity, as far as I understand, is consistent and uniform so pressure from gravity wouldn't force liquid rock to squirt like a giant zit. Is it the variable nature of gravity's effect from the moon and sun? Localized pressure from tectonic activity or other localized causes?

submitted by /u/rossionq1
[link] [comments]

Are there different (human) brain types?

Posted: 04 May 2022 12:21 AM PDT

I am aware of the unproven psychological theory of brain types, my question is not about that theory.

It is about the factual biological differences and the exsistence of possible types based on the differences. Like there are only a few different hair coulour that differs genetically or a few different blood types, or baldness patterns. Has such differences been researched or discovered in relation to brains? For example something like average dendrite length, or some people has or doesn't have a specific type of neuron?

submitted by /u/Superb-Locksmith-228
[link] [comments]

How do we know how much ice Earth had 100,000s of years ago?

Posted: 03 May 2022 08:52 AM PDT

What would be observed by two objects moving at near-light speed towards one another?

What would be observed by two objects moving at near-light speed towards one another?


What would be observed by two objects moving at near-light speed towards one another?

Posted: 03 May 2022 10:38 AM PDT

From how I understand it, all velocities are relative, and nothing can surpass the speed of light. So I would assume this means you can't observe anything move faster than C, but what I can't grasp is what an object moving at, say, 99% of C would observe if another object was moving at the same velocity towards it. Would it be observed as moving nearly twice the speed of light? Or would some special relativity time dilation fuckery make this impossible?

submitted by /u/WarCrimeKirby
[link] [comments]

Has Earth always been in the Sun’s habitable zone? If not, when did it start to occupy the Goldilocks zone?

Posted: 03 May 2022 08:18 PM PDT

Is crying an inflammatory process?

Posted: 03 May 2022 08:21 PM PDT

After I cry, especially for a while, my eyes feel sore and my eyelids get puffy and red, and they can take almost a day to feel back to normal. I also feel tired for the next +/-12 hours.

Is there an inflammatory feedback mechanism from crying?

Also, this brings up another question: does anyone know the scientific or evolutionary origin and purpose of crying? Is it an adaptation?

Thanks 🥲

submitted by /u/broccoleye
[link] [comments]

AskScience AMA Series: We're Rachel Davis, MD, and Moksha Patel, MD, instructors at the CU School of Medicine. With Rachel's expertise, Moksha decided to undergo deep brain stimulation surgery for OCD. AUA!

Posted: 03 May 2022 04:00 AM PDT

Hi, Reddit. We're Rachel Davis, MD, (u/racheldavismd) and Moksha Patel, MD, (u/mokshapatelmd). We're here to answer your questions about deep brain stimulation and OCD, obsessive compulsive disorder. If you are struggling with OCD, you are not alone. Treatments and care are evolving.

Deep brain stimulation or DBS is a rare, invasive brain surgery where electrodes are implanted in the deeper structures of the brain. These electrodes are then connected to generators in the chest that deliver small currents of electricity to the brain, similar to cardiac pacemakers.

About Rachel:

I'm Rachel Davis, MD, associate professor of psychiatry at the University of Colorado School of Medicine. I'm also medical director of the OCD, Obsessive Compulsive Disorder, program and co-director of the OCD surgical program. I've extensively studied deep brain stimulation for OCD and have worked with candidates, like Moksha, before, during and after the process.

About Moksha:

And I'm Moksha Patel, senior instructor of hospital medicine at the University of Colorado School of Medicine where I hold many roles. I've always been high-achieving and busy my whole life; working hard has helped me cope with crippling OCD. I recently worked with Dr. Davis and many others to undergo deep brain stimulation.

I've put in a lot of work with Dr. Davis programming my stimulator settings and engaging in intensive exposure therapy. It's been a challenging process, but I'm happy to say I'm feeling relief; I am more engaged in life and can travel, go out with friends and go about my day to day without being completely stuck in my head. I'm also working toward an MBA at the University of Colorado Denver.

Links:

We'll begin answering questions at 9AM MT (8AM PT/11AM ET/15 UT). AUA!

submitted by /u/AskScienceModerator
[link] [comments]

Why isn't 'apparent gravity' greater at the poles?

Posted: 03 May 2022 09:21 AM PDT

If centifugal force increases with the radius of rotation (all else staying the same), why doesn't our apparent weight vary depending on our relative distance from the equator i.e. if there is less centrifugal force at the North/South Pole to balance the constant gravity, why don't we feel like we weigh more?

submitted by /u/BACTERIAMAN0000
[link] [comments]

Do we have a wider field of view when our pupils dilate in the dark?

Posted: 02 May 2022 07:11 PM PDT

In the dark our pupils get wider, which I would imagine means there is a larger angle of light that we can see, and the opposite for our pupils shrinking in brightness. Is this actually how it works?

submitted by /u/immediatesword
[link] [comments]

What are the trade-offs for waiting longer in between COVID booster shots in terms of long-term and short-term protection?

Posted: 03 May 2022 12:12 PM PDT

It's my understanding that waiting longer between COVID boosters allows for a greater production of both regular B cells and plasma cells (the latter of which are a type of B cell that sit in our bone marrow, producing antibodies for long periods of time). And I've seen some experts, such as E. John Wherry, point out that spacing boosters close together, even four months apart, may result in a trade-off between short-term protection against infection provided by antibodies and long-term protection from infection from severe disease and death conferred by B cells and T cells.

I'm curious just how significant this trade-off is. If one had a booster four months ago, would they be more likely to get better long-term protection against severe outcomes if they were to wait an additional four or five months for a fall booster? Or is the trade-off for waiting relatively minor, such that they would be likely to get better overall protection if they were to get a booster now and then again in the fall, in about six months? (In addition to being less likely to catch COVID for the next two months or so after getting a booster.)

submitted by /u/TheMoniker
[link] [comments]

Soybeans look very similar to other green beans. What makes soybeans produce so much more oil? There is no green bean oil, or english pea oil, or edamame oil.

Posted: 03 May 2022 08:50 PM PDT

Why do so many new drug names end in umab?

Posted: 02 May 2022 11:19 PM PDT

Just wondered what it's derived from. I've seen many drugs ending in umab or mab, especially in clinical trials.

submitted by /u/BSwollocks
[link] [comments]

Are there any elements that we've only found on Earth and there's no evidence of them elsewhere?

Posted: 03 May 2022 06:46 PM PDT

Why do mammalian antibodies have a light chain?

Posted: 03 May 2022 12:56 PM PDT

So I'm reading about antibodies, saw that sharks and camels don't have light chains in their antibodies, tried to look more into why they only have heavy chains and found (according to what I read) that they are more stable, smaller, have higher affinity, and can go places where antibodies with light chains can't. So now the question I can't find an answer to is why have a light chain then? Like why do most other large animals have a light chain if it seems to make your antibodies less effective?

TL;DR Having no light chain in your antibody seems to make it a better antibody, so why do most mammals have antibodies with light chains?

submitted by /u/PepperJack_
[link] [comments]

Is there any correlation between the sequence of gRNA used and the probability of the template DNA being accepted and used for Homologous Recombination?

Posted: 03 May 2022 05:58 PM PDT

I recently completed a self-directed experiment where I used CRISPR-Cas9 to edit non-pathogenic E. coli so that it would grow on streptomycin agar media. I forced a mutation in the ribosomal subunit protein rpsL to change a single DNA base, so the Lysine amino acid at position 43 is replaced with Threonine. It was successful as I did see small bacteria colonies on my agar plates, but it was much less than it should have been.

I had ordered premade gRNA (GGAGTTCGGTTTTTTAGGAG) in order to complete this experiment. The protocol I followed recommended this sequence because of its closeness to the actual position in the gene and because it would increase the likelihood of the template DNA being accepted into the cell for Homologous Recombination.

Is there any correlation between the sequence of gRNA used and the probability of the template DNA being accepted and used for Homologous Recombination? I feel like this is very far-fetched but I am curious. Sorry if this is confusing, please let me know if I need to clarify anything.

submitted by /u/hyperventionn
[link] [comments]

Why is cold water better for removing blood than hot water?

Posted: 02 May 2022 04:21 PM PDT

If you were standing on Mars, how bright would it’s two moons look in comparison to our Moon on Earth?

Posted: 01 May 2022 08:26 PM PDT

Why is IgE antibody always associated with pollen but other types not? What exactly is the impact of the type of antibody?

Posted: 03 May 2022 07:05 AM PDT

Does our brain have some sort of internal timer/alarm clock when something becomes a routine?

Posted: 02 May 2022 03:17 PM PDT

In my early teens my parents had a parental control in the family computer which included allowing only 4 hours of screen time in my profile. When it reached the last 15 minutes it would show a prompt with a few options. The thing is that after a few months and maybe a year of this parental control I started "sensing" when the 15 minutes prompt would appear, to the point where I would pause my game or whatever I was doing to wait for it to appear so I could close it, and I never had to wait for more than 1 or 2 minutes for that (every now and then I would get a false alarm but those were rare). I would just start getting a "bad" feeling when it was going to happen, almost as if my brain started a timer when I logged into the computer and it would go off when the "bad thing" was about to happen. And no, I wasn't looking at the clock, I was too into my game to the point where I would forget to blink. Just asking this because I got curious when remembering this, and I'm a potato when it comes to psychology or neuroscience or whatever this falls into.

submitted by /u/MOM_UNFUCKER
[link] [comments]

China has used "fireworks" to break up cloud formations and bring blue skies. Could this technique be used to dissipate a tornado, to save lives and reduce damage?

Posted: 01 May 2022 07:39 PM PDT

When a broken bone heals improperly and it needs to be re-broken, how do doctors ensure it breaks correctly to heal properly again?

Posted: 02 May 2022 08:05 PM PDT

Is there any research being done on reducing tick populations?

Posted: 02 May 2022 05:22 PM PDT

I live in Nova Scotia, Canada my entire life and honest to God I had never seen or even heard of ticks IRL until recent years. To note: I've never been much of an outdoorsy/woods type person to begin with. Now that we have to do tick checks every single time we take the dog outside, and the fact that my house is in a rural area surrounded by tall grass and forests, the thought of ticks and Lyme is a regular source of nightmare fuel for me.

The news of an upcoming vaccine for Lyme does not comfort me, because no date or rollout anytime soon means it might as well not even be news. I hate these fucking things just as much as anyone else. While I wasn't interested in interacting with nature before, now I'm just anxious about it.

I understand climate change is mainly causing the booming population. Deer population seemingly being at an all time high around here also adds to it.

All I'd like to know is this: What, if any, research or science (yes this sounds dumb) is being done to combat this in the slightest? This is a worldwide issue by now, and I hate the idea that we are all just gonna have to accept our new tick overlords.

submitted by /u/AmbitiousSlide3029
[link] [comments]

In what way do SSRI (antidepressant) cause long term sexual dysfunction?

Posted: 02 May 2022 04:36 PM PDT

In the literature there have been rising number of studies/reviews done on PSSD (post ssri sexual dysfunction), with the recent track since the EMA accepted it as a syndrome page 5.

​

submitted by /u/boopkilla
[link] [comments]

Is the sky a different colour blue at different latitudes?

Posted: 02 May 2022 12:32 PM PDT

I recently traveled from Canada to the Bahamas. When I left the sky was a pale icy blue, when I arrived the sky seemed darker, closer to indigo blue. Is Raleigh scattering affected by latitude? Was it another atmospheric phenomenon or was it just my imagination?

submitted by /u/Latvian_Pete
[link] [comments]

Could we ride a conventional bike on the Moon?

Posted: 02 May 2022 09:34 AM PDT

If spacesuits were as light and flexible as normal clothing would we be able to ride a conventional mountain-bike on the Moon?

My question regards the physics of riding the bike, not the economics or the feasibility of such an endeavor.

submitted by /u/pauelena
[link] [comments]

Why would land surface temperature be higher than air temperature?

Posted: 02 May 2022 02:58 PM PDT

So I stumbled upon this post, and it got me thinking about why land temperature would be higher than the air temperature. I suspect it's a heat capacity thing but I'm having trouble taking that concept and using it to arrive at why that would be the case.

submitted by /u/onceyouhadgold
[link] [comments]

Do fruit trees always need a “partner” to bear fruit?

Posted: 02 May 2022 12:32 PM PDT

As I understand, a fruit (for example, an apple) is created when the flowers of a tree get pollinated. So, if I were to plant a single apple tree on an island in the middle of the ocean, it would not bear any fruit right? Is this the case for all trees or are there any that can give fruit "asexually"?

submitted by /u/ROCA99
[link] [comments]

Sunday, May 1, 2022

Why can't we reproduce the sound of very old violins like Stradivariuses? Why are they so unique in sound and why can't we analyze the different properties of the wood to replicate it?

Why can't we reproduce the sound of very old violins like Stradivariuses? Why are they so unique in sound and why can't we analyze the different properties of the wood to replicate it?


Why can't we reproduce the sound of very old violins like Stradivariuses? Why are they so unique in sound and why can't we analyze the different properties of the wood to replicate it?

Posted: 01 May 2022 06:49 AM PDT

What exactly stops us from just making a 1:1 replica of a Stradivarius or Guarneri violin with the same sound?

submitted by /u/UnityBlade111
[link] [comments]

How does the position one is in (sitting, standing, laying down), affects the way one processes their emotions?

Posted: 01 May 2022 05:34 AM PDT

It feels really stupid, but I find that there is a difference between how I process and perceive emotion while sitting vs. while standing. Is this really true, or is just circumstantial? Is there a difference in how humans might react to certain emotions depending on their physical stance?

submitted by /u/jabhiram
[link] [comments]

Is it true that fasting makes our cells age at slower rates?

Posted: 01 May 2022 04:36 AM PDT

Title itself.

submitted by /u/B99fanboy
[link] [comments]

With change in atmospheric pressure, which value will not change, gauge pressure or absolute pressure?

Posted: 01 May 2022 05:42 AM PDT

I never encountered in projects where there is atmospheric pressure other than 14.7 psia.

In this particular scenario, my atmospheric pressure is 13.3 psia.

One of the software has output of 30 psig, assuming the atmospheric pressure as 14.7psig.

So if I want to interpret the output, should I keep psig or psia should be constant with varying atmospheric pressure?

submitted by /u/Zonten77
[link] [comments]

Can extreme iron deficiency anemia cause WBC and platelet count to decrease over time?

Posted: 01 May 2022 02:51 AM PDT

If it does, how so?

submitted by /u/beyondtheleaves
[link] [comments]

What is the difference between coke and charcoal?

Posted: 01 May 2022 02:02 AM PDT

Thanks for reading. I have tried googling this but it is very confusing and most sources talk about coal vs. coke, not charcoal vs. coke. I understand the superficial differences, coke being derived from the destructive distillation of coal and charcoal being derived from the pyrolysis of wood. I also understand both are essentially high purity carbon.

However the terms are often used differently and in different contexts, and I can't think of what the difference would be (unless they are different allotropes In which case how exactly are they different?). I'm especially interested in when and most importantly why you would use coke for a process instead of charcoal, or vice versa.

I was looking up how calcium carbide is produced and Wikipedia says it's made with coke, but other sources seem to imply any carbon powder is sufficient, which is where my confusion originated (if that's helpful). Disclaimer: I have zero intention of actually using or making any of these compounds, I know enough lab safety to know I do not know nearly enough lab safety, I am just interested in the theory and the chemistry behind the processes.

submitted by /u/Elequosoraptor
[link] [comments]

What is the importance of the Quality of Soil? And how does one measures it?

Posted: 01 May 2022 05:05 AM PDT

I recently heard that the Quality of soil is getting degraded. And it is affecting the amount of nutrients which in turn affects causes nutrient deficiency(Cause of many diseases).

submitted by /u/nothingarc
[link] [comments]

Why does the river decrease its competence along its course, if the last course can be faster than the first?

Posted: 30 Apr 2022 10:11 PM PDT

I have a question about the working system of the river environment while studying geology. The topic that led me to this question is: why does the competence of a river decrease along its course?

I understand from the texts that the competence of a river course is intimately and mainly related to the speed, so the river course of greater speed is able to transport sediments of greater size, presenting a greater competence, and jointly preventing the deposition, and the the opposite happens with rivers of lower speed. But I was mainly in doubt about how speed is established in the courses of a river system.

1.) In some texts, authors considered the upper course of a river to be the fastest in the fluvial system due to the gradient of declination, and consequently, as this slope gradient tends to become less expressive in the middle and lower courses, the speed also reduces, explaining the reduction in the competence of a river along its entire course.

2.) In other texts, they say that the fastest course of a river is the lower course, this is because it presents little friction and turbulence compared to the middle and upper course, even with the slope gradient, the speed of these courses would be limited by friction.

Which consideration of the fastest course is correct? And especially, if the second is correct: Why does the river decrease its competence along its course, if the last course can be faster than the first?

Thanks in advance.

submitted by /u/redsun831
[link] [comments]

How do scientists determine the age of documented specimens when they don’t have any data on supposed adult stage specimens?

Posted: 30 Apr 2022 08:13 PM PDT

I was reading about the bigfin squid, and the person writing about it claimed scientists have only discovered larval, paralarval, and juvenile stage specimens, but the wording suggested it's all based off of photo/video evidence. If we haven't found a large batch of them to study and compare age differences within, or watched any of them grow over time, how can it be determined that the ones seen aren't adults?

submitted by /u/jellysmacks
[link] [comments]

How do materials determine the rate of heat transfer if they have different thermal conductivity properties?

Posted: 30 Apr 2022 08:03 PM PDT

Sorry if this is a really dumb question,

I was wondering about what the rate of heat transfer would be you were to touch a metal object that has a very low temperature, since laws of thermodynamics states that heat from higher temperature objects (your hand) travels to low temperature objects (the metal object) wouldn't the rate of heat transfer be determines by how thermally conductive your hand is rather then the metal? and since skin is a good insulter I would think theoretically it would take a while for your hand to get cold.

However in reality the thermal conductivity properties of the metal determines the rate of transfer not your hand, so why is this the case despite the way thermal energy travels?

submitted by /u/The_Ninja_Behind_You
[link] [comments]